Thursday, 20 April 2017

Delightful DNA Day Deep Discounts

Don't dilly-dally. Devour DNA Day discounts.

AGCCTATTTTGCGCAAAGCCTATTTTGCGCAAAGCCTATTTTGCGCAA

The Living DNA test is $40 Cdn off, $159 discounted from $199.

Family Tree DNA have discounts on many of their tests, Family Finder is $59 US, down from $79 US.

AncestryDNA are advertising $30 Cdn off their test through 25 April.

MyHeritage has $20 US off, now $79 UK.

Nothing yet from 23andMe.

AGCCTATTTTGCGCAAAGCCTATTTTGCGCAAAGCCTATTTTGCGCAA

Don't dare dawdle!

Discounts disappear!

No comments: