Sunday, 23 April 2017

Ancestry Updates Obituary Collections

Canada, Obituary Collection, 1898-2015, 1,266,544 records
UK and Ireland, Obituary Index, 2004-2017, 1,077,844 records

are the most recent updates to the Ancestry obituary collections.

The US and Australia & New Zealand collections are also updated.

Alberta Genealogical Society Conference: Day 1








Congratulations to the organizers of the Alberta Genealogical Society conference being held in Edmonton this weekend, billled as "Ye Olde Genealogy Faire". The venue was expertly decorated on the theme by members of the Red Deer Branch.











Some of the presenters, including David and Celia Tyler from Raymond, Alberta, were dressed for the occasion.





The attendence was a record for the society, 300 counting presenters and exhibitors.











Winner of the Ancestry door prize for a 0ne year full Ancestry subscription was Solveig Anderson.






Aside for the organizers the hardest working person at the event was Diahan Southard who gave three presentations and the evening banquet talk.

St George`s Day Feast

It`s 23 April. Celebrate St George`s Day in style

What more appropriate than a serving of fish and chips

https://telescoper.wordpress.com/2010/08/26/150-years-of-fish-and-chips/

Saturday, 22 April 2017

Findmypast updates Easter Rising & Ireland Under Martial Law 1916-1921

With this addition of over 76,000 records this database now totals 204,630 records. Findmypast describe them as "prisoner lists, case files, search reports, court-martials and much more."

Dig slightly further and read that

 "created in partnership with The National Archives in London and contains 91 pieces from their WO35 series, War Office: Army of Ireland: Administration and Easter Rising Records. The pieces from the collection (from WO 35 and HO 144) include court-martial registers, reports of the events of Easter Rising week, search and raid reports, files of civilians tried by court-martial, and internment camp and prison registers."

"What We Leave Behind." War Memory, Vimy Ridge and the British Commonwealth

The Ottawa Historical Association,
in collaboration with
Library and Archives Canada, presents a lecture:

"What We Leave Behind."
War Memory, Vimy Ridge and the British Commonwealth 

by Robert Engen, Assistant Professor, Royal Military College of Canada,
and Andrew Horrall, Senior Archivist, Library and Archives Canada.

Tuesday, May 9, 2017, at 7:00 p.m.
395 Wellington Street, 2nd Floor
Ottawa, Ontario
Library and Archives Canada

Register at www.bac-lac.gc.ca/eng/about-us/events/Pages/Event%20Registration.aspx?eventid=22

Presentation in English
This free lecture is open to the public.

Friday, 21 April 2017

Newspapers.com adds Guardian and Observer

British newspapers available on newspapers.com make a quantum leap with the addition of the Guardian and Observer -- 1,094,632 pages from editions between 1821-2003.

Gordon Flowerdew, home child?

Following on yesterday's post about the Yarmouth Independent becoming available on the British Newspaper Archive, I took the opportunity to check it out at the Ottawa City Archives. BIFHSGO has purchased a subscription for use by visitors to the Archives .
This article about Eric Flowerdew and his wife, successful poultry farmers in BC, caught my attention.  He came from a large Norfolk farming family, and served with British Forces during the First World War arriving in Canada shortly thereafter.
The article, from April 1927, ends with the advice that "Canadian farmers want real workers. For that class there is every chance. Others had better stay away."
A name like Flowerdew is one we all wish we had to research. Google popped up one Gordon Flowerdew, Eric's older brother, who was posthumously awarded the Victoria Cross serving with the Canadian Expeditionary Force.
His biography in the DCB ends "Flowerdew is of some interest both for the way he lived and for the manner of his death. Like many other young Britons, he had come to Canada at the turn of the century to seek his fortune without giving up his British roots and had volunteered to fight for the empire in 1914. Tragically, but also typically, he died carrying on a military tradition centuries-old but set in a different, industrialized style of warfare."
Gordon Flowerdale arrived in Canada in 1903, one of the pre-war immigrants from Britain I'll be speaking about at the Alberta Genealogical Society conference this week end. He appears in the Home Child database on the LAC website but given his age on immigration, 18, and background he doesn't fit the profile of the typical home child.

Thursday, 20 April 2017

Delightful DNA Day Deep Discounts

Don't dilly-dally. Devour DNA Day discounts.

AGCCTATTTTGCGCAAAGCCTATTTTGCGCAAAGCCTATTTTGCGCAA

The Living DNA test is $40 Cdn off, $159 discounted from $199.

Family Tree DNA have discounts on many of their tests, Family Finder is $59 US, down from $79 US.

AncestryDNA are advertising $30 Cdn off their test through 25 April.

MyHeritage has $20 US off, now $79 UK.

Nothing yet from 23andMe.

AGCCTATTTTGCGCAAAGCCTATTTTGCGCAAAGCCTATTTTGCGCAA

Don't dare dawdle!

Discounts disappear!

British Newspaper Archive adds Yarmouth Independent

One of my presentations to this weekend's Alberta Genealogical Society conference is on British Newspapers, a resource I enjoy using and speaking about.


Visiting the British Newspaper Archive site to update one of the slides I found the latest addition is an extended selection of issues, over 2,000, of the Yarmouth Independent, published in my home-town of Great Yarmouth. That's over 22,000 pages for the years 1862-1863, 1868, 1871, 1876-1877, 1879, 1882, 1885, 1889-1893, 1901, 1903, 1906-1910, 1913-1914, 1916-1917, 1919-1927, 1932-1937. No longer can I complain that my part of England is ignored by the BNA.

I'd planned on suggesting to AGS conference attendees that everyone with British ancestry try a one month BNA subscription. It's a bargain, half the cheap day return fare on Southwest Trains into London and the British Library when I stay with family.

Check out the places in your British and Irish family history. Chances are there's information on an ancestor in the BNA that will be new to you.

Ancestry adds UK, Military Indexes, 1920-1971

Ancestry describes these lists as comprising "the names and service numbers of those who were discharged from the armed forces after 1920 and born before 1901. Details given for over 300,000 (371,716) individuals found within this collection may include (where available):

Initial and Surname
Date of Birth
Their Service
Service Number
Ministry of Defence Reference Number."
It's most likely to be useful for the date of birth information.

The source, "public sector information licensed under the Open Government Licence v3.0," leads to a collections of datasets hosted by the UK National Archives. I found little of genealogical interest, many are merely catalogue entries for unpublished datasets.

Ottawa Branch OGS April Meeting

This Saturday, 22 April 2017, the program from the Ottawa Branch starts at 10:30 am with a Back To Basics! educational session on the Ontario Genealogical Society given by President Patti Mordasewicz.

That's unless instead you plan on attending the Scottish Genealogy Group which meets at 10:00 am.

The main event in the afternoon, starting at 1 pm with a 30 minute social period, is a presentation on Library and Archives Canada's DigiLab by Melanie Brown.
"The digitization of collections held by Library and Archives Canada (LAC) is inviting academics, individuals, genealogists and community-based groups to engage in digitizing LAC collections. The newly-established DigiLab at 395 Wellington Street in Ottawa is a hands-on facility for users to digitize and contextualize LAC collections of value to their study, work and communities. All of the material digitized through the DigiLab will be made available online for general public access.
The goal of the DigiLab is to facilitate digitization projects that make available a range of materials from LAC’s vast collections that may not otherwise be digitized.  By working with and meeting the needs of a variety of users and communities, LAC will expand its digital content and make this documentary heritage available to everyone."
As one of the few people who have used DigiLab, which only opened this month, I can attest to the potential. The image captures the three types of scanners available.

The computer interest group will meet following the main event.

It's all happening at the City of Ottawa Archives, 100 Tallwood Drive

Wednesday, 19 April 2017

YouTube: Sources for Genealogical Research in the National Archives, Ireland

The Genealogical Society of Ireland was given a lecture on 11 April 2017 by Tom Quinlan, Keeper at the (Irish) National Archives on the organization holdings of genealogical interest.
It covers the main resources, available both online and those for which you need to visit the physical archive. You'll get a good understanding of why things are as they are, and right at the end a couple of minutes on plans for further records to be made available online.

OGS Kingston Branches April Meeting

The Kingston Branch of the Ontario Genealogical Society will meet at the Kingston Seniors Centre, 56 Francis Street in Kingston on Saturday, April 22 at 10 a.m.  Gary Foster, president of Campbell Monuments in Belleville, will speak on "The Story Behind the Stones: Reading the Monuments". Visitors always welcome.  Further details at www.ogs.on.ca/kingston